# Example trimming, aligning, and read counting commands for sequencing results from libraries prepared with the Zymo-Seq RiboFree Total RNA Library Kit (R3000/R3003) with instruction manual v2.0.0.
# Feel free to use different tools from the listed for each step.
# Feel free to add more steps as you see fit. These commands and steps are only for your reference.

# Trimming, using the publicly available tool TrimGalore! (https://github.com/FelixKrueger/TrimGalore.git).
trim_galore --paired -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a2 AGATCGGAAGAGCGTCGTGTAGGGAAAGA sample.R1.fastq.gz sample.R2.fastq.gz

# Aligning, using the publicly available tool STAR (https://github.com/alexdobin/STAR.git). 
# Here, the output is set to be bam for the subsequent read counting step. Feel free to change the value or omit this option as you see fit.
# Feel free to adjust the number of threads that fits with the number of available cores on your computer/server. 
# Feel free to use more options as you see fit.
STAR --genomeDir ./path/to/STARIndex/ --readFilesIn sample.R1_val_1.fastq.gz sample.R2_val_2.fastq.gz --runThreadN 4 --outSAMtype BAM SortedByCoordinate --readFilesCommand zcat --outFileNamePrefix sampleName

# Generate a bai file to prepare for the subsequent read counting step, using the publicly available tool Samtools (http://www.htslib.org/)
samtools index sampleNameAligned.sortedByCoord.out.bam

# Count aligned reads by exons and group the counts by gene IDs, using publicly available tool featureCounts (https://rnnh.github.io/bioinfo-notebook/docs/featureCounts.html).
featureCounts -a genesGTF.gtf -g gene_id -t exon -o sampleName_gene.featureCounts.txt -p -s 2 sampleNameAligned.sortedByCoord.out.bam